View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_26 (Length: 292)
Name: NF19744_high_26
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 10 - 161
Target Start/End: Original strand, 47349274 - 47349425
Alignment:
| Q |
10 |
attatactttgcttcacttgtctttgttattgctattcttattccacattttctaatgggactgtttttgtttggggcagtagtagtagtagctttctct |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349274 |
attacactttgcttcacttgtctttgttattgctattcttattccacattttctaatgggactgtttttgtttggggcagtagtagtagtagctttctct |
47349373 |
T |
 |
| Q |
110 |
ctttctttcttttgtcttcctcaataatttagagggtttacaattacccatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349374 |
ctttctttcttttgtcttcctcaataatttagagggtttacaattacccatg |
47349425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 47349494 - 47349543
Alignment:
| Q |
227 |
gctttgtgtatgtgcgtgtctagggtggggtctggtcacaccctctttct |
276 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349494 |
gctttgtgtatgtgtgtgtctagggtggggtctggtcacaccctctttct |
47349543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University