View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_35 (Length: 253)
Name: NF19744_high_35
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_35 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 2655297 - 2655056
Alignment:
| Q |
13 |
attattcttaatggtcttagaagcattccggtaaaaccagtcttgtctttagattcatgaaatcatgttgtgaaaaatagagaaaattttg-tggtaaag |
111 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2655297 |
attattcttaatggtctcagaagcattgcggtgaaaccggtcttgtctttagattcatgaaatcatgttgtgaaaaatagagaaaattttggtggtaaag |
2655198 |
T |
 |
| Q |
112 |
ttttgattcctttggtgatattttcctgaaaaatggttctcttattttcttcgtgagttttcttatttacatatatttagttgaggaaggggcattgaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2655197 |
ttttgattcctttggtgatattttcctgaaaaatggttctcttattttcttcgtgagttttcttatttacatatatttagttgaggaaggggcattgaat |
2655098 |
T |
 |
| Q |
212 |
ggttctgcttttggtgcagaatcattaagatgttcaaattct |
253 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2655097 |
ggttctgcttttggtgcagaataattaagatgttcaaattct |
2655056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University