View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_49 (Length: 230)
Name: NF19744_high_49
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 12320542 - 12320756
Alignment:
| Q |
1 |
attatcatattatcaacacttatggtaaatgcattggcaactcatgaacatgaaaacaagccctcttgcattcaaaatggcaaatatcatacaaaatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12320542 |
attatcatattatcaacacttatggtaaatgcattggcaactcatgaacatgaaaacaagccctcttgcattcaaaatggcaaatatcttacaaaatcac |
12320641 |
T |
 |
| Q |
101 |
aacacttctttccttgtcaactaatgctcatagac-aaaactcatgtcagaaccttattggttagcctcacaataaggaagaaaattccacaacttgagc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320642 |
aacacttctttccttgtcaactaatgctcatagacaaaaactcatgtcagaaccttattggttagcctcacaataaggaagaaaattccacaacttgagc |
12320741 |
T |
 |
| Q |
200 |
attaaatgttgccaa |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12320742 |
attaaatgttgccaa |
12320756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University