View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_54 (Length: 223)
Name: NF19744_high_54
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 90 - 189
Target Start/End: Complemental strand, 52000409 - 52000310
Alignment:
| Q |
90 |
tctagtggtgtctttgaaactaagctaaaagcataattcagtcatatgtttaaaactataaagcacatacgagtaatcatgtgtttaaaatccatctttc |
189 |
Q |
| |
|
||||||||| | ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52000409 |
tctagtggtattgttgaaaccaagctaaaagcataatttagtcatatgtttaaaactataaagcacatacgaggaatcatgtgtttaaaatccatctttc |
52000310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University