View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_27 (Length: 328)
Name: NF19744_low_27
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 103 - 316
Target Start/End: Original strand, 19165899 - 19166110
Alignment:
| Q |
103 |
ggacatatcaagagattaagaacgactcgacgacgcaggtaatgggcttgaagtttgacatagcagggatgactctagggtttatcaacggtcttcacaa |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19165899 |
ggacatatcaagagattcagaacgactcgacgacacaggtaatgggctggaagtttgacatagcagggatgactctagggtttattaacggtcttcacaa |
19165998 |
T |
|
| Q |
203 |
ggtttggcggatgcgattccttctacaggtggtacaggcaagtgcgtttctactcatgcgcgtttgtacgtgaatggcatatggcttatgagctcgacat |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
19165999 |
ggtttggcagatgcgattccttctacaggtggtacaggaaagtgcgtttctactcatgcgcgtttgtacgtgaatggc--atggcttctgagctcgacat |
19166096 |
T |
|
| Q |
303 |
ttatgattagaatg |
316 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19166097 |
ttatgattagaatg |
19166110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 99
Target Start/End: Original strand, 19165754 - 19165793
Alignment:
| Q |
60 |
caaccgcgccggagtaactcgctggcggagacgaacattg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19165754 |
caaccgcgccggagtaactcgctggcggagaggaacattg |
19165793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 43
Target Start/End: Original strand, 19165726 - 19165758
Alignment:
| Q |
11 |
cagagagagaggtcatgagagtcacggccaacc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19165726 |
cagagagagaggtcatgagagtcacggccaacc |
19165758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University