View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_31 (Length: 292)
Name: NF19744_low_31
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 26309998 - 26309725
Alignment:
| Q |
1 |
tcaatgtgaaccaagttggattcattgtatatgactaagtttattgtctcaattcttgaaacaataactttattcatttaggatggtggactcaatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26309998 |
tcaatgtgaaccaagttggattcactgtatatgactaagtttattatctcaattcttgaaacaataactccattcatttaggatggtggactcaatatat |
26309899 |
T |
|
| Q |
101 |
tgcggagaaactaatggagtttaaaatatagttgatcatttggtgaatattgaggaagaggataagtctttacttttattgtgtctgttacctataccct |
200 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26309898 |
tgcagagaaaccaatggagtttaaaatatagttgatcatttggtgaatattgaggaagaggataagtctttacttttattgtgtctgttacctataccat |
26309799 |
T |
|
| Q |
201 |
tcgagcacttcaatgataatatactttatggaaaagaaggcactatcactttagatgaggtctaatcagagaac |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26309798 |
tcgagcacttcaatgataatatactttatggaaaagaaggcactatcactttagatgaggtctaatcggagaac |
26309725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 90
Target Start/End: Complemental strand, 32429328 - 32429288
Alignment:
| Q |
50 |
caattcttgaaacaataactttattcatttaggatggtgga |
90 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
32429328 |
caattcttgaaacaacaactctactcatttaggatggtgga |
32429288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University