View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_36 (Length: 284)
Name: NF19744_low_36
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 123
Target Start/End: Original strand, 42794155 - 42794266
Alignment:
| Q |
12 |
tactttcctactacacggcgcctggcctgtagatactactaatcccagaactcatttgatagcagacccaaatgcacctgcttttgacgtggtacaattt |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42794155 |
tactttcctactatacggcgcctggcctgtagatactactaatcccaaaactcagttgatagcagacccaaatgcacctgcttttgacgtggtacaattt |
42794254 |
T |
|
| Q |
112 |
catcttaacaat |
123 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42794255 |
catcttaacaat |
42794266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 188 - 269
Target Start/End: Original strand, 42794331 - 42794412
Alignment:
| Q |
188 |
cggaggcgcaaaagcaaatgttagaacacatgtggcgtgatataaaaaatggagatgacattaagttttgggaggaacagtg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42794331 |
cggaggcgcaaaagcaaatgttagaacacatgtggcgtgatataaaaaatggagatgacattaagttttgggaggaacagtg |
42794412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University