View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_44 (Length: 250)
Name: NF19744_low_44
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 7413843 - 7414075
Alignment:
| Q |
1 |
tggtttgtggccttcaaacatagtgtggcctcaacccccaggtttcacatttgtgcaatatgttttcaaatatgtgagtttatttaaattctccttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7413843 |
tggtttgtggccttcaaacatagtgtggcctcaacccccacgtttcacatttgtgcaatatgttttcaaatatgtgagtttatttaaattctcattttat |
7413942 |
T |
|
| Q |
101 |
gactttctgttgtcatgatgg-tagaatatggctttttattgcattccttttactagatttatagtttgaagtcagatcttagtacttcttggccagatg |
199 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7413943 |
gactttctgttgtcatcatggttagaatatgactttttattgcattccttttactagatttatagtttgaagtgagatcttagtacttcttggccagatg |
7414042 |
T |
|
| Q |
200 |
ttggtggcacttatgatagtttctgtcagagac |
232 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
7414043 |
ttggtggcacttgtgatagtttctgtcagagac |
7414075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University