View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_49 (Length: 248)
Name: NF19744_low_49
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 26217681 - 26217609
Alignment:
| Q |
19 |
tatgatagggtccactacacttctattaacaatgacggagtaatccataattcaaacacacaacataatcgaa |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217681 |
tatgacagggtccactacacttctattaacaatgacggagtaatccataattcaaacacacaacataatcgaa |
26217609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 147 - 248
Target Start/End: Complemental strand, 26217609 - 26217495
Alignment:
| Q |
147 |
aatccagcctatcataggatttactaatataaagtctatgagctacattaccttgattaactttcacct-------------atgaacaatttcaatggt |
233 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26217609 |
aatccaacctatcataggatttactaatataaagtctatgagctacattaccttgattaactttcaccttaggtttcacacgatgaacaatttcaatggt |
26217510 |
T |
|
| Q |
234 |
tgtcattgcattatc |
248 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26217509 |
tgtcattgcattatc |
26217495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University