View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_56 (Length: 234)
Name: NF19744_low_56
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7413349 - 7413572
Alignment:
| Q |
1 |
actaatcatagttaa-gtgaaactcttgattgatgtgaagttaaatatannnnnnngagcaaaatgtgaggttagatattgttgcttagagttatgataa |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7413349 |
actaatcatagttaaagtgaaactcttgattgatgtgaagttaaatatatttttt-gagcaaaatgtgaggttagatattgttgcttagagttatgataa |
7413447 |
T |
 |
| Q |
100 |
acaaggttcttttaatataaaaattgacaacgttgcaatttaaataaggaaaatgttaaaagatattccttggtatcggttaagaaaacaaatatagtac |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7413448 |
acaaggt-cttttaatataaaaattgacaacgttgcattttaaataaggaaaatgttaaaaggtatttcttggtatcggttaagaaaacaaatacagtat |
7413546 |
T |
 |
| Q |
200 |
tttattgcattgggaattatgtaatc |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7413547 |
tttattgcattgggaattatgtaatc |
7413572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 57 - 128
Target Start/End: Complemental strand, 7379286 - 7379216
Alignment:
| Q |
57 |
agcaaaatgtgaggttagatattgttgcttagagttatgataaacaaggttcttttaatataaaaattgaca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
7379286 |
agcaaaatgtgaggttagatattgttgcttagagttatggtaaacaagg-tcttttaacacaaaaattgaca |
7379216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University