View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_low_58 (Length: 229)
Name: NF19744_low_58
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 33126820 - 33126626
Alignment:
| Q |
18 |
atggggttatgtttcaagaattattcaatttgagatctaattatgttattttgtttggaacagcttgaagcatgttcctggcttcattgagagatcagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126820 |
atggggttatgtttcaagaattattcaatttgaaatctaattatgttattttgtttggaacagcttgaagcatgttcctggcttcattgagagatcagaa |
33126721 |
T |
 |
| Q |
118 |
gagctgaaaggaaagggagttgatgaaatcatctgcatcagtggtaaagtttctagtcatatatcatgattttgttatctataatgattgtgttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126720 |
gagctgaaaggaaagggagttgatgaaatcatctgtatcagtggtaaagtttctagtcatatatcatgattttgttatctataatgattgtgttg |
33126626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University