View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19745_high_6 (Length: 379)
Name: NF19745_high_6
Description: NF19745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19745_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 17 - 367
Target Start/End: Original strand, 14346311 - 14346661
Alignment:
| Q |
17 |
aacttcctttaacgagattcgagtgtgaggtactgaactggttgaatatttctccgactcaacttcatcctaacagttgggcttttgctcgcgctttcga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
14346311 |
aacttcctttaacgagattcgagtgtgaggtactgaactggttgaatatttctccgtctcaacttcatcctaacagttgggcttttgctagcgcgttcga |
14346410 |
T |
|
| Q |
117 |
atgccttcttacctattatggtttggaagtgtctgctgctttgtttttctgnnnnnnncaggttaagattggaaaacaagtgggttgggtttcgattaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14346411 |
atgccttcttacctattatggtttggaagtgtctgctgctttgtttttctgtttttttcaggttaagattggaaaacaagtgggttgggtttcgattaat |
14346510 |
T |
|
| Q |
217 |
ggtattccgggtcgaaaattgttggagagctttgatcaatcttataaaaactttaaagctaggttttttaaaatttgggctgttccaggtgaaccttatt |
316 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14346511 |
ggtattccgggtcgaaaattgtttgagagctttgatcaatcttataaaaactttaaagctaggttttttaaaatttgggctgttccaggtgaaccttatt |
14346610 |
T |
|
| Q |
317 |
ttcttttgaatagggatgatggtaagccattgtttcctttatattggtctc |
367 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14346611 |
ttcttttgaataaggatgatggtaagccattgtttcctttatattggtctc |
14346661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University