View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19745_low_10 (Length: 221)

Name: NF19745_low_10
Description: NF19745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19745_low_10
NF19745_low_10
[»] chr3 (1 HSPs)
chr3 (16-211)||(47294901-47295096)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 47295096 - 47294901
Alignment:
16 tataaactgccacagtttttgttgttttaggtgttggtttgctgttactatgagttaggtcggtgcttgttgcaacttacagaaacgcaaccctgcatga 115  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47295096 tataaactgccacagtttttgttgttttaggtgttagtttgttgttactatgagttaggtcggtgcttgttgcaacttacagaaacgcaaccctgcatga 47294997  T
116 agcaaattcatgggaactggttttgcatgttctagaaagtggaatccgttaccagaatctatagtttttggaattcaactgtttacaaggcctttg 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
47294996 agcaaattcatgggaactggttttgcatgttctagaaagtggaatccgttaccagaatctttagtttttggaattcaactgtttacaaggcttttg 47294901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University