View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19745_low_10 (Length: 221)
Name: NF19745_low_10
Description: NF19745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19745_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 47295096 - 47294901
Alignment:
| Q |
16 |
tataaactgccacagtttttgttgttttaggtgttggtttgctgttactatgagttaggtcggtgcttgttgcaacttacagaaacgcaaccctgcatga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47295096 |
tataaactgccacagtttttgttgttttaggtgttagtttgttgttactatgagttaggtcggtgcttgttgcaacttacagaaacgcaaccctgcatga |
47294997 |
T |
 |
| Q |
116 |
agcaaattcatgggaactggttttgcatgttctagaaagtggaatccgttaccagaatctatagtttttggaattcaactgtttacaaggcctttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
47294996 |
agcaaattcatgggaactggttttgcatgttctagaaagtggaatccgttaccagaatctttagtttttggaattcaactgtttacaaggcttttg |
47294901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University