View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19745_low_8 (Length: 273)
Name: NF19745_low_8
Description: NF19745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19745_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 5 - 260
Target Start/End: Original strand, 25752279 - 25752534
Alignment:
| Q |
5 |
caaacactatctctcacattggttgtttctcgttagggctgaaaataggtaaacacacgttgcagttaggaaacaaatctgctcttccaagcatttccaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25752279 |
caaacactatctctcacattggttgtttctcgttagggctgaaaataggtaaacacacgttgcagttaggaaacaaatctgctcttccaagcatttccaa |
25752378 |
T |
 |
| Q |
105 |
atgaagaaattaaatgcaactttttgtggaaagcgagtgaaccctaaataaatatcttcaaaatagtcacttattgatgatgcctgcaccactcactcac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25752379 |
atgaagaaattaaatgcaactttttgtggaaagcgagtgaaccctaaataaatatcttcaaaatagtcacttattgatgatgcctgcaccactcactcac |
25752478 |
T |
 |
| Q |
205 |
tgaaaatctcttttatttcatgaccctacaatcatatcatagttgaaatccccttc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25752479 |
tgaaaatctcttttatttcatgaccctacaatcatatcatagttgaaatccacttc |
25752534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University