View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19746_high_4 (Length: 234)
Name: NF19746_high_4
Description: NF19746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19746_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 19 - 165
Target Start/End: Complemental strand, 25682164 - 25682017
Alignment:
| Q |
19 |
attatataaaaggcagatcatagaaaataattttttcccaaatatcttaggatttatttggattgttgaagttggatggaatcgagacatttgaaacata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
25682164 |
attatataaaaggcagatcatagaaaataatttttttccaaatatcttaggatttgtttggattgttgaagttggatggaattgagacctatgaaacata |
25682065 |
T |
 |
| Q |
119 |
tcttaagagaga--ttttatcaaaataaatatcttaaagagaccctgat |
165 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25682064 |
tcttaagagagattttttatcaaaataaatatc-tcaagagaccctgat |
25682017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University