View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19746_low_3 (Length: 335)
Name: NF19746_low_3
Description: NF19746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19746_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 4113516 - 4113834
Alignment:
| Q |
1 |
tagttgctagtaagaactatgtgtagaagaagacctgaagccataacaactgtttgtagcttgcaacaattattttgttagaaatgaaaatgacgacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113516 |
tagttgctagtaagaactatgtgtagaacaagaactggagccataacaactgtttgtagcttgcaacaattattttgttagaaatgaaaatgacgacttt |
4113615 |
T |
|
| Q |
101 |
ggctattagtttcaattatatgtttggtggtgtgaaaattttcttgcaacacaatcaataaatgcacaactctcattggtgtttcttagggtaagttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113616 |
ggctattagtttcaattatatgtttggtggtgtgaaaattttcttgcaacacaatcaataaatgcacaactctcattggtgtttcttagggtaagttcaa |
4113715 |
T |
|
| Q |
201 |
acaaattgtggttacactacacttttatcaatttccaaacacatgcttagactcgtgagcttgagttttagtcaaactttgttagcttccctgctacctg |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113716 |
acaaattgtggtgacactacacttttatcaatttccaaacacatgcttagactcgtgagcttgagttttagtcaaactttgttagcttccctgctacctg |
4113815 |
T |
|
| Q |
301 |
gcctgtttggattgatttg |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4113816 |
gcctgtttggattgatttg |
4113834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University