View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19747_high_22 (Length: 236)
Name: NF19747_high_22
Description: NF19747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19747_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 44756797 - 44756914
Alignment:
| Q |
1 |
aaaaagggagaaagagttatctgtgaggacacgtattttgctgtcgttaggaattatgttgtgacgtaaattggatgggcttcccaatctaattttgact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44756797 |
aaaaagggagaaagagttatctgtgaggacacgtattttgctgtcgttaggaattatgttgtgacgtaaattggatgggcttcccaatctaattttgact |
44756896 |
T |
|
| Q |
101 |
tatataaaacgatcataa |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44756897 |
tatataaaacgatcataa |
44756914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 44756972 - 44757021
Alignment:
| Q |
172 |
taattatggccctatcgttgttctatcttcatgatattgtaatttgtagg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44756972 |
taattatggccctatcgttgttctatcttcatgatattgtaatttgtagg |
44757021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University