View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19747_high_8 (Length: 378)
Name: NF19747_high_8
Description: NF19747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19747_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 239 - 360
Target Start/End: Complemental strand, 36902002 - 36901881
Alignment:
| Q |
239 |
tatagtcatgaatcgtgagtcatgaagcaaagaaaaaattaccttggtgattcttgctagcacctgagattagttttgagataacctatggtacttcgtg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36902002 |
tatagtcatgaatcgtgagtcatgaagcaaagaaaaaagtaccttagtgattcttgcttgcacctgagactagttttgagataacctatggtacttcgtg |
36901903 |
T |
 |
| Q |
339 |
ggctaaggttgacccctgacac |
360 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36901902 |
ggctaaggttgacccctgacac |
36901881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 99 - 207
Target Start/End: Complemental strand, 36902195 - 36902087
Alignment:
| Q |
99 |
aatgttaaataatgtcctagtgaagacatatttgtaagtaaatttactttggttttgcaagacaaactaacctgtgtttggtgtagagggaaacttcccc |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36902195 |
aatgttaaataatgtccgagtgaagacatatttgtaagtaaatttaatttggttttgcaagacaaactaacctgtctttggtgtagagggaaacttcccc |
36902096 |
T |
 |
| Q |
199 |
acatgagat |
207 |
Q |
| |
|
||| ||||| |
|
|
| T |
36902095 |
acaggagat |
36902087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University