View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19747_low_17 (Length: 284)
Name: NF19747_low_17
Description: NF19747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19747_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 51531842 - 51531592
Alignment:
| Q |
16 |
atgaatcatttttctactatagtaaggaaaatggttgcgtgcatgcacggnnnnnnnnngacatgagaatgtgtgtgattgatgacattttcatttattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51531842 |
atgaatcatttttctactatagtaaggaaaatggttgcgtgcatgcacggaaaaaaaaagacatgagaatgtgtgtgattgatgacattttcatttattc |
51531743 |
T |
|
| Q |
116 |
atgtgtgttttatgttaaagattttaatccttaccgagtatattactctttatcatgaagaagatcgtgaataacacttgttcaattttaagaagaaaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51531742 |
atgtgtgttttatgttaaagattttaatccttaccgagtatattactctttattatgaagaacatcgtgaataacacttgttcaattttaagaagaaaat |
51531643 |
T |
|
| Q |
216 |
ggatattggtaagtaattacttttttccctagaaatcattggtctctgtca |
266 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51531642 |
ggatattgctaagtaattacttttttccctagaaatcattggtctctgtca |
51531592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 51531109 - 51531059
Alignment:
| Q |
75 |
gacatgagaatgtgtgtgattgatgacattttcatttattcatgtgtgttt |
125 |
Q |
| |
|
||||||||||||||||| |||| |||| ||||||||||||| | ||||||| |
|
|
| T |
51531109 |
gacatgagaatgtgtgtaattggtgactttttcatttattcgtttgtgttt |
51531059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University