View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19747_low_19 (Length: 262)
Name: NF19747_low_19
Description: NF19747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19747_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 30607931 - 30607685
Alignment:
| Q |
16 |
catttgtccacatatactcttatgtcatatcaaacaacaacagttcaaagaggaattcgacataacctacttggcaaatttaagagtctagtttgactca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30607931 |
catttgtccacatatactcttatgtcatatcaaacaacaacagttcaaagaggaattcgacacaacctacttggcaaatttaagagtctagtttgactca |
30607832 |
T |
 |
| Q |
116 |
tgcactagttcttctgtcttcatacatcttagcaaaataattatgagataagttttacgattgagatattacaatttctcttcaacattatcatttttgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30607831 |
tgcactagttcttctgtcttcatacatcttagcaaaataattatgagataagttttacgattgagatattacaatttctcttcaacattatcatttttgg |
30607732 |
T |
 |
| Q |
216 |
atgatctattatcatcaatatgaagatatatttttgcacttttgcac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30607731 |
atgatctattatcatcaatatgaagatatatttttgcacttttgcac |
30607685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University