View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_high_29 (Length: 377)
Name: NF19748_high_29
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 49446146 - 49446503
Alignment:
| Q |
1 |
gaggcagggaagtctaatggaagtaaagcccttcacagagaaacgctgaaatttgagaacaacaagagtcttgcagctgagaatgctaataggcaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446146 |
gaggcagggaagtctaatggaagtaaagcccttcacagagaaacgctgaaatttgagaacaacaagagtcttgcagctgagaatgctaataggcaattta |
49446245 |
T |
 |
| Q |
101 |
ggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttgacccatttgacgacatggggaaagccaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446246 |
ggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttgacccatttgacgacatggggaaagccaatga |
49446345 |
T |
 |
| Q |
201 |
tgccctcctcaccatatgtaatgccaaggcaaaaacttttgatggaattacgtgaaagcaaaacagaatacacagactagctgaagcgaaaacaggcttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49446346 |
tgccctcctcaccatatgtaatgccaaggcaaaaacttttgatggaattacgtgaaagcaaaacagaatacacagactcgctgaagcgaaaacaggcttc |
49446445 |
T |
 |
| Q |
301 |
ttggtgatatagctctgtgttgctgaagttgatagcgagaactgagcaccatagatgt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446446 |
ttggtgatatagctctgtgttgctgaagttgatagcgagaactgagcaccatagatgt |
49446503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University