View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_high_47 (Length: 303)
Name: NF19748_high_47
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 44407036 - 44407160
Alignment:
| Q |
1 |
tatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttagtggcattttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407036 |
tatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttagtggcattttcat |
44407135 |
T |
 |
| Q |
101 |
tttatgattcaaataaaaccctgtg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44407136 |
tttatgattcaaataaaaccctgtg |
44407160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 181 - 287
Target Start/End: Original strand, 44407221 - 44407327
Alignment:
| Q |
181 |
tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttctattcctctcagtatgccaaggtgctttgtcttatacagat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407221 |
tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttctattcctctcagtatgccaaggtgctttgtcttatacagat |
44407320 |
T |
 |
| Q |
281 |
ggtaagt |
287 |
Q |
| |
|
||||||| |
|
|
| T |
44407321 |
ggtaagt |
44407327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University