View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_high_58 (Length: 269)
Name: NF19748_high_58
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 194283 - 194516
Alignment:
| Q |
18 |
aaatccacctgtctcatgtttgattaataatcctttcattctatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194283 |
aaatccacctgtctcatgtttgattaacaatcctttcattccatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaa |
194382 |
T |
|
| Q |
118 |
tcatgtgcttccttctcttcttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgc |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194383 |
tcatgtgcttccttctctacttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgc |
194482 |
T |
|
| Q |
218 |
ctctgttgaattatgatcaagtccctagcttctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
194483 |
ctctgttgaattatgatcaagtccctagcttctt |
194516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University