View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_high_65 (Length: 252)
Name: NF19748_high_65
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_high_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 13 - 164
Target Start/End: Complemental strand, 35182371 - 35182218
Alignment:
| Q |
13 |
ttatactaggagtggttggcttatctaagagattgaattttgagaagttagtcttagtgcttttgagnnnnnnncccttcgtgtttagtttatgtgcttt |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35182371 |
ttattctaggagtggttggcttatctaagagattgaattttgagaagttagtcttagtgcttttgtagttttttcccttcgtgtttagtttatgtgcttt |
35182272 |
T |
 |
| Q |
113 |
aagtatcccttgagggttttgagt--atttttatactttgtaccattttattta |
164 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
35182271 |
aagtatcccttgagggttttgagttattttttatattttgtaccattttattta |
35182218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 157 - 252
Target Start/End: Complemental strand, 35181515 - 35181420
Alignment:
| Q |
157 |
tttatttaatagtatactctttgtgacctcgagtatatttttacaattcaaaagataaaagttcttcaatccttgtgatctgagttcgatactgtc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35181515 |
tttatttaatagtatactctttgtgacctcgagtatatttttacaattcaaaagataaaagttcttcaatccttgtgatctgagttcgatactgtc |
35181420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University