View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_high_73 (Length: 238)
Name: NF19748_high_73
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 97 - 220
Target Start/End: Complemental strand, 35181304 - 35181181
Alignment:
| Q |
97 |
ttcataaaagaaagtttaggtgagttgaatttcaagactcatcatagtcaggatagacctcaagagtgtttatagagatatttatatatcatcgtctaaa |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35181304 |
ttcataaaagaaagtttaggtaagttgaatttcaaaactcatcatagtcaggatagatctcaagagtgtttatagagatatttatatatcattgtctaaa |
35181205 |
T |
 |
| Q |
197 |
tcgatcatcacattgataatgaaa |
220 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
35181204 |
tcgatcatcacactgataatgaaa |
35181181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35181403 - 35181356
Alignment:
| Q |
1 |
agaataaaaagaagtttttctattatggtaagttattctaaaaaattta |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35181403 |
agaataaaaagaagtttttctattatggtaagttattcta-aaaattta |
35181356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 147
Target Start/End: Complemental strand, 28291821 - 28291781
Alignment:
| Q |
107 |
aaagtttaggtgagttgaatttcaagactcatcatagtcag |
147 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||| |
|
|
| T |
28291821 |
aaagtttaggtgagttggatttcaggactcatcagagtcag |
28291781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University