View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_29 (Length: 391)
Name: NF19748_low_29
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 8 - 344
Target Start/End: Complemental strand, 39525525 - 39525189
Alignment:
| Q |
8 |
tagcaaaggtagaaattcaccttattaagcccttgagtaactgttgccaaaatgggcattgtttcagacaacaacaactgctcaatatgcaaaatggaag |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39525525 |
tagcgaaggtagaaattcaccttattaagcccttgagtaactgttgccaaaatgggcattgtttcagacaacaacagctgctcaatatgcaaaatggaag |
39525426 |
T |
|
| Q |
108 |
acgaataaactgcaagtatctcaacaatgccattagcaagagccctacgataaacactaggcttctccttattctccaaagggttggcattttcagacct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39525425 |
acgaataaactgcaagtatctcaacaatgccattagcaagagccctacgataaacactaggcttctccttattctccaaagggttagcattttcagacct |
39525326 |
T |
|
| Q |
208 |
tatccagtttaaattcctagacttggccgaaaatcgttccaactctctatagtaaaatcccaacgtgattatcctctcaataagctccctgcaatcaata |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525325 |
tatccagtttaaattcctagacttggccgaaaatcgttccaactctctatagtaaaatcccaacgtgattatcctctcaataagctccctgcaatcaata |
39525226 |
T |
|
| Q |
308 |
caattcacttcaaaatctcaaccttcaacatgcccac |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525225 |
caattcacttcaaaatctcaaccttcaacatgcccac |
39525189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University