View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_46 (Length: 311)
Name: NF19748_low_46
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 134 - 298
Target Start/End: Complemental strand, 38694675 - 38694512
Alignment:
| Q |
134 |
agggaatatatatctacttgaaatatatggttaggcctaactccgtggcattgattttcgttactctactatgatatgtcggggtcggtcggttgggtat |
233 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38694675 |
agggaatatatatctatttgaaatatatggttaggccaaactccgtgacattgattttcgttactctactatgatatgtcggggtcggtcggttgggtat |
38694576 |
T |
|
| Q |
234 |
gtttaaggtaaactgtcaaaatttaattattatggtattatgaggttgcttgaggataaaaattt |
298 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38694575 |
g-ttaaggtaaactgtcaaaatttaattattatggtattatgaggttgcttgaggataaaaattt |
38694512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 38695099 - 38695007
Alignment:
| Q |
23 |
ggtaatggaaatttaggtcagtgggtcatgatatgggacaagatatggagtttggaatatgctaaaatatttgataaatc-aaagagcatatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38695099 |
ggtaatggaaatttaggtcagtgggtcatgatatgggacaagatatggagtttggaatatgctaaaatatttgataaatcaaaagagcatatc |
38695007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University