View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_47 (Length: 310)
Name: NF19748_low_47
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_47 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 194306 - 193998
Alignment:
| Q |
1 |
atcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaaccctctctagctgtggcaaatacacatccaagtcaagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
194306 |
atcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaaccatctctagttgtggcaaatacacatccaagtcaagcc |
194207 |
T |
 |
| Q |
101 |
gttttggttcattctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcctatcacaacttccttctcttcttctaaatctctagcttt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194206 |
gttttggttcatcctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcctatcacaacttccttctcttcttctaaatctctagcttt |
194107 |
T |
 |
| Q |
201 |
tctcatctctttgccccagcttttctggtgtgcaaaaagtcactgccaaaccttttgaggccaacagcttccccagcctcaatagagggttcacgtgtcc |
300 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194106 |
tctcatctctttgccccagc-tttctagtgtgcaaaaagtcactgccaaaccttttgaggccaacagcttccccagcctcaatagagggttcacgtgtcc |
194008 |
T |
 |
| Q |
301 |
ttgcgccggg |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
194007 |
ttgcgccggg |
193998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University