View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_49 (Length: 304)
Name: NF19748_low_49
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 4162118 - 4162411
Alignment:
| Q |
1 |
gattaattaaagcttataaagcaaggttaacacggcaataccaaaaaggagggtcgtaagagtgaatactaaggatgatcataactgaaaaggctatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4162118 |
gattaattaaagcttataaagcaaggttaacacggcaataccaaaaaagagggtcgtaagagtgaatactaaggatgatcataactgaaaaggctatatt |
4162217 |
T |
 |
| Q |
101 |
atagcttctttccctatgtgccctcatttttacttaaaacaaaaagagagactatttagtagtattatttgcttttgctaactacaaagcaaaatgggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4162218 |
atagcttctttccctatgtgccctcatttttacttaaaacaaaaagagagactatttagtagtattatttgcttttgctaactacaaagcaaaatgggaa |
4162317 |
T |
 |
| Q |
201 |
attgatttgccaacagatgtaatcatataaaaggc---------tataacaagctgtcacatataatcgaacctttcgcttgcatcagttgtgact |
287 |
Q |
| |
|
||||||||||||||||||| || | ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4162318 |
attgatttgccaacagatgcaa--acataaaaggctatacagcatataacaagctgtcacatataatcggacctttcgcttgcatcagttgtgact |
4162411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University