View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_56 (Length: 286)
Name: NF19748_low_56
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_56 |
 |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0115 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 278
Target Start/End: Original strand, 45581 - 45848
Alignment:
| Q |
11 |
cacagatgacccaaaggaacttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45581 |
cacagatgacccaaaggaacttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgt |
45680 |
T |
 |
| Q |
111 |
tttttggttggcatgtacttactcttatggaaaatttcgcacctaaggacccagtgtttgatatctttataggcatatggttaaagaaacgatgcggcca |
210 |
Q |
| |
|
|| ||||||||||| ||||||||||| || |||||||||||||| |||||||| ||||| | |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
45681 |
ttcttggttggcatttacttactcttctgaaaaatttcgcacctgaggacccaatgtttcacatctttataggcatctggtcaaagaaacgatgcggcca |
45780 |
T |
 |
| Q |
211 |
ttctggatagagttggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45781 |
ttctggctagagttggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
45848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University