View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_61 (Length: 277)
Name: NF19748_low_61
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 7666190 - 7666431
Alignment:
| Q |
17 |
acttcaaaactaccactgtcattaatattttctctttcatatttcttaccaataatatcatcaaatttaccctccnnnnnnnnnnnncttgatttgataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7666190 |
acttcaaaactaccactgtcattaatattttctctttcatatttctcaccaataatatcattaaatttaccctcctttttcttttttcttgatttgataa |
7666289 |
T |
 |
| Q |
117 |
tcaaaaatatagctagtgaaattattactacacttgttataacaataccaataatctgcaatgacttatgcttactgttatcaggcacagtcacaataac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666290 |
tcaaaaatatagctagtgaaattattactacacttgttataacaataccaataatctgcaatgacttatgcttactgttatcaggcacagtcacaataac |
7666389 |
T |
 |
| Q |
217 |
attacttggaataggatttgtttgttgcactgtattgttggt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666390 |
attacttggaataggatttgtttgttgcactgtattgttggt |
7666431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University