View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19748_low_63 (Length: 269)

Name: NF19748_low_63
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19748_low_63
NF19748_low_63
[»] chr5 (1 HSPs)
chr5 (18-251)||(194283-194516)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 194283 - 194516
Alignment:
18 aaatccacctgtctcatgtttgattaataatcctttcattctatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaa 117  Q
    ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
194283 aaatccacctgtctcatgtttgattaacaatcctttcattccatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaa 194382  T
118 tcatgtgcttccttctcttcttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgc 217  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
194383 tcatgtgcttccttctctacttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgc 194482  T
218 ctctgttgaattatgatcaagtccctagcttctt 251  Q
    ||||||||||||||||||||||||||||||||||    
194483 ctctgttgaattatgatcaagtccctagcttctt 194516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University