View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19748_low_75 (Length: 248)

Name: NF19748_low_75
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19748_low_75
NF19748_low_75
[»] chr2 (2 HSPs)
chr2 (1-153)||(36946174-36946326)
chr2 (193-230)||(36946321-36946358)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 36946174 - 36946326
Alignment:
1 tggtttcgcaacatctcttgcaaccgaggcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgat 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36946174 tggtttcgcaacatctcttgcaaccgaagcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgat 36946273  T
101 agcagcactaaatatcagagaaggttgttagtaatctctttacttgttaacac 153  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36946274 agcagcactaaatatcagagaaggttgttagtaatctctttacttgttaacac 36946326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 36946321 - 36946358
Alignment:
193 taacacaaaagtttggctggttttattggtgctgactt 230  Q
    ||||||||||||||||||||||||||||||||||||||    
36946321 taacacaaaagtttggctggttttattggtgctgactt 36946358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University