View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_75 (Length: 248)
Name: NF19748_low_75
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 36946174 - 36946326
Alignment:
| Q |
1 |
tggtttcgcaacatctcttgcaaccgaggcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946174 |
tggtttcgcaacatctcttgcaaccgaagcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgat |
36946273 |
T |
 |
| Q |
101 |
agcagcactaaatatcagagaaggttgttagtaatctctttacttgttaacac |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946274 |
agcagcactaaatatcagagaaggttgttagtaatctctttacttgttaacac |
36946326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 36946321 - 36946358
Alignment:
| Q |
193 |
taacacaaaagtttggctggttttattggtgctgactt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946321 |
taacacaaaagtttggctggttttattggtgctgactt |
36946358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University