View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_76 (Length: 244)
Name: NF19748_low_76
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 42382210 - 42381973
Alignment:
| Q |
1 |
aagttatgccgtctgatgtgattgaccgtggcaaatcaggatatcgtagcttctcttcgttggaatctactgatcctttaccatcaggctgttgccactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42382210 |
aagttatgccgtctgatgtgattgaccatggcaaatcaggatatcgtagcttctcttcgttggaatctactgatcctttaccatcaggctgttgccactt |
42382111 |
T |
 |
| Q |
101 |
gagactgttaaccttctgtttcgccgactttaaaacatttgaaaaatagttactctttttatcatcaccttcctgagcataaaaagcatgattgccccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42382110 |
gagactgttaaccttctgtttcgccgactttaaaacatttgaaaaatagttactctttttatcatcaccttcctgagcataaaaagcatgattgccccaa |
42382011 |
T |
 |
| Q |
201 |
aaacgagttctttctgtctgagaatttggtgatgatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42382010 |
aaacgagttctttctgtctgagaatttggtgatgatgt |
42381973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University