View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19748_low_8 (Length: 593)

Name: NF19748_low_8
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19748_low_8
NF19748_low_8
[»] scaffold0001 (4 HSPs)
scaffold0001 (350-491)||(506613-506755)
scaffold0001 (16-145)||(506910-507039)
scaffold0001 (244-303)||(506755-506814)
scaffold0001 (549-579)||(506524-506554)


Alignment Details
Target: scaffold0001 (Bit Score: 119; Significance: 2e-60; HSPs: 4)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 350 - 491
Target Start/End: Complemental strand, 506755 - 506613
Alignment:
350 aattatgataatgaggacaaataattttgaaatgttgattttagtgttggtataaaaaagacatataggtaaggttatggtagatt-cggtggaccaacg 448  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||    
506755 aattttgataatgaggacaaataattttgaaatgttgattttagtgttggtataaaaaagacatataagtaaggttatggtagattgcggtggaccaacg 506656  T
449 ttatccacattcggttaaactatgatttctaactttgcacaga 491  Q
    ||||||||||||||||||| ||||||||||||||||| |||||    
506655 ttatccacattcggttaaaatatgatttctaactttgtacaga 506613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 507039 - 506910
Alignment:
16 ctgtggagtgaccggttcgaattgtctaatgaatcgctacactttcaaaccggcgtgagctggtgcaacttgaacaaaactggcaaaccaacggtttcga 115  Q
    ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| |||||| || |||||| ||    
507039 ctgtggagtgaccggttcgaattgtctaatgaatcactacgctttcaaaccggcgtgagctggtgcaacttggtcaaaaccggcaaatcagcggttttga 506940  T
116 caaaccagaccggttcaatatgaatgcagc 145  Q
    ||||||||||| |||||||| ||| |||||    
506939 caaaccagaccagttcaatacgaaagcagc 506910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 244 - 303
Target Start/End: Complemental strand, 506814 - 506755
Alignment:
244 atttaaaatgattaattgatgaatttaggatccaaatttcgatacatgtatattataata 303  Q
    ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||    
506814 atttaaaatgattaattgatgaatttaggatccaaatttagatccatgtatattataata 506755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 579
Target Start/End: Complemental strand, 506554 - 506524
Alignment:
549 atctatctcttacttccactactaattaatg 579  Q
    |||||||||||||||||||||||||||||||    
506554 atctatctcttacttccactactaattaatg 506524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University