View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19748_low_8 (Length: 593)
Name: NF19748_low_8
Description: NF19748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19748_low_8 |
 |  |
|
| [»] scaffold0001 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 119; Significance: 2e-60; HSPs: 4)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 350 - 491
Target Start/End: Complemental strand, 506755 - 506613
Alignment:
| Q |
350 |
aattatgataatgaggacaaataattttgaaatgttgattttagtgttggtataaaaaagacatataggtaaggttatggtagatt-cggtggaccaacg |
448 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
506755 |
aattttgataatgaggacaaataattttgaaatgttgattttagtgttggtataaaaaagacatataagtaaggttatggtagattgcggtggaccaacg |
506656 |
T |
 |
| Q |
449 |
ttatccacattcggttaaactatgatttctaactttgcacaga |
491 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
506655 |
ttatccacattcggttaaaatatgatttctaactttgtacaga |
506613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 507039 - 506910
Alignment:
| Q |
16 |
ctgtggagtgaccggttcgaattgtctaatgaatcgctacactttcaaaccggcgtgagctggtgcaacttgaacaaaactggcaaaccaacggtttcga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||| || |||||| || |
|
|
| T |
507039 |
ctgtggagtgaccggttcgaattgtctaatgaatcactacgctttcaaaccggcgtgagctggtgcaacttggtcaaaaccggcaaatcagcggttttga |
506940 |
T |
 |
| Q |
116 |
caaaccagaccggttcaatatgaatgcagc |
145 |
Q |
| |
|
||||||||||| |||||||| ||| ||||| |
|
|
| T |
506939 |
caaaccagaccagttcaatacgaaagcagc |
506910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 244 - 303
Target Start/End: Complemental strand, 506814 - 506755
Alignment:
| Q |
244 |
atttaaaatgattaattgatgaatttaggatccaaatttcgatacatgtatattataata |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
506814 |
atttaaaatgattaattgatgaatttaggatccaaatttagatccatgtatattataata |
506755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 579
Target Start/End: Complemental strand, 506554 - 506524
Alignment:
| Q |
549 |
atctatctcttacttccactactaattaatg |
579 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
506554 |
atctatctcttacttccactactaattaatg |
506524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University