View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1974_high_15 (Length: 208)
Name: NF1974_high_15
Description: NF1974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1974_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 5 - 164
Target Start/End: Original strand, 35232262 - 35232421
Alignment:
| Q |
5 |
gggtagattatactgatatgaatcatatatcgagttcaaatagagagcaatggtatgacataattttggatctaagcaagccaaagagtttttggatcat |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35232262 |
gggtagattatattgatatgaatcatatatagagttcaaatagagagcaatggtatgacataattttggatctaagcaagccaaagagtttttggatcat |
35232361 |
T |
 |
| Q |
105 |
attgaaagtttacttgcaagttgcaaatacactttcatatatctttttaatgtctcattt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35232362 |
attgaaagtttacttgcaagttgcaaatacactttcatatatctttttaatgtctcattt |
35232421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 35232486 - 35232430
Alignment:
| Q |
5 |
gggtagattatactgatatgaatcatatatcgagttcaaatagagagcaatggtatg |
61 |
Q |
| |
|
||||| |||||| || |||||||||| ||| |||| |||| |||||||||||||||| |
|
|
| T |
35232486 |
gggtaaattatattggtatgaatcatttatagagtacaaagagagagcaatggtatg |
35232430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University