View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1974_low_12 (Length: 223)
Name: NF1974_low_12
Description: NF1974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1974_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 39238283 - 39238471
Alignment:
| Q |
18 |
acgtttgccattgtttcaatcaccatcacacttcttagaggaaaaacagcatctgcaaatgttttgtttcgaccaagaacagaaggacccaatactatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39238283 |
acgtttgccattgtttcaatcaccatcacacttcttagaggaaaaacagcatctgcaaatgttttgtttcgaccaagaacagaaggacccaatactatcc |
39238382 |
T |
 |
| Q |
118 |
ctccctgcattcacacaacataacatgtatatttaacaagataactttaccaaaatttatgaccttcaataaaatgattctaggagtat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39238383 |
ctccctgcattcacacaacataacatgtatatttaacaagataactttaccaaaatttatgaccttcaataaaatgattctaggagtat |
39238471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 86
Target Start/End: Original strand, 44056420 - 44056482
Alignment:
| Q |
24 |
gccattgtttcaatcaccatcacacttcttagaggaaaaacagcatctgcaaatgttttgttt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||| |||||| ||| |||| |
|
|
| T |
44056420 |
gccattgtttcaatcaccatcacacttcttagagggaaaactgcattggcaaatatttcgttt |
44056482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University