View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1974_low_14 (Length: 219)
Name: NF1974_low_14
Description: NF1974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1974_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 7108800 - 7109016
Alignment:
| Q |
1 |
aaattatcagagaatatgagtttaaaatgacctctatccaattacaaatgttttcattaaaaccaaaagctttcaaaatcttcaaaagaaattttcattc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108800 |
aaattatcagacaatatgagtttaaaatgacctctatccaattccaaatgttttcattaaaaccaaaagctttcaaaatcttcaaaagaaattttcattc |
7108899 |
T |
|
| Q |
101 |
cacagtgtcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggagaagatcggttgcctctcaagtgaggttgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
7108900 |
cacagtgtcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggcgaagatcgggtgcctctcaagtgaggttgatg |
7108999 |
T |
|
| Q |
201 |
cactctttgatttgtct |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7109000 |
cactctttgatttgtct |
7109016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University