View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19750_high_12 (Length: 300)

Name: NF19750_high_12
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19750_high_12
NF19750_high_12
[»] chr7 (2 HSPs)
chr7 (133-287)||(30020207-30020359)
chr7 (22-63)||(30020429-30020470)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 133 - 287
Target Start/End: Complemental strand, 30020359 - 30020207
Alignment:
133 attgcaattgcaatggttacgatgtatataatccacaaggtcacgatatttcgctttaacaaagtgtacccctcttttgtcnnnnnnnntgtacccttct 232  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||    
30020359 attgcaattgcaatggttacgatgtata--atccacaaggtcacgatatttcgctttaacaaagtgtacccctcttttgtcaaaaaaaatgtacccttct 30020262  T
233 taaagtttggagggtaattaatttaattcatacgcctaaagttaaaatttagtat 287  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
30020261 taatgtttggagggtaattaatttaattcatacgcctaaagttaaaatttagtat 30020207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 22 - 63
Target Start/End: Complemental strand, 30020470 - 30020429
Alignment:
22 taatagacagattttattaaattttagagaagaaattggatg 63  Q
    ||||||||||||||||||||||||||||||||||||||||||    
30020470 taatagacagattttattaaattttagagaagaaattggatg 30020429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University