View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_high_20 (Length: 239)
Name: NF19750_high_20
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_high_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 41277229 - 41277442
Alignment:
| Q |
19 |
cgaacatcttctattacattgcggacactagaacaaaacaacacacaaaataatgaaatattaatgtcaaaaaccctcttccttcttcaattattgccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277229 |
cgaacatcttctattacattgcggacactagaacaaaacaacacacaaaataatgaaatattaatgtcaaaaaccctcttccttcttcaattattgccat |
41277328 |
T |
 |
| Q |
119 |
atcaattttcaatcaaacacattataaaattaccttcccagaatattttttctgttgaagccattttctgacgcatgacatgccataaatgtgtccacaa |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277329 |
atcaattttcaatcaaac-------aaaattaccttcccagaattttttttctgttgaagccattttctgacgcatgacatgccataaatgtgtccacaa |
41277421 |
T |
 |
| Q |
219 |
ggaagacaactaaaatcattc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41277422 |
ggaagacaactaaaatcattc |
41277442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University