View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_high_21 (Length: 229)
Name: NF19750_high_21
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 5753991 - 5753765
Alignment:
| Q |
1 |
tacataaggtggattggattctcctctttcaaccagattttttaatatatatgagtaataaatcaaacgttgttcacttgcttaacgagctcaagttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5753991 |
tacataaggtggattggattctcctcttccaatcaaattttttaatacatatgaacaataaatcaaacgttgttcacttgcttaacgagctcaagttctc |
5753892 |
T |
 |
| Q |
101 |
taccacttgaatccatccatta-ttttatggttgataacattcaaatannnnnnnaattactatctattactatatnnnnnnnnntcttactaattgtat |
199 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5753891 |
taccacttgaatccatccattatttttttggttgataacattcaaatatttttttaattactatctattactatatcaaaaaaaatcttactaattgtat |
5753792 |
T |
 |
| Q |
200 |
ttaatgtctagttcaaccgatgatgtt |
226 |
Q |
| |
|
||| |||| ||||||||||||||||| |
|
|
| T |
5753791 |
ataacgtcttgttcaaccgatgatgtt |
5753765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University