View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_low_14 (Length: 300)
Name: NF19750_low_14
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 133 - 287
Target Start/End: Complemental strand, 30020359 - 30020207
Alignment:
| Q |
133 |
attgcaattgcaatggttacgatgtatataatccacaaggtcacgatatttcgctttaacaaagtgtacccctcttttgtcnnnnnnnntgtacccttct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30020359 |
attgcaattgcaatggttacgatgtata--atccacaaggtcacgatatttcgctttaacaaagtgtacccctcttttgtcaaaaaaaatgtacccttct |
30020262 |
T |
|
| Q |
233 |
taaagtttggagggtaattaatttaattcatacgcctaaagttaaaatttagtat |
287 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30020261 |
taatgtttggagggtaattaatttaattcatacgcctaaagttaaaatttagtat |
30020207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 22 - 63
Target Start/End: Complemental strand, 30020470 - 30020429
Alignment:
| Q |
22 |
taatagacagattttattaaattttagagaagaaattggatg |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30020470 |
taatagacagattttattaaattttagagaagaaattggatg |
30020429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University