View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_low_21 (Length: 241)
Name: NF19750_low_21
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 47493245 - 47493053
Alignment:
| Q |
14 |
aatatatttaactttaaataatatttaaggtggtagattaatccttnnnnnnnnttgtagattagtggtaagaatttaatcttgtaatcttaagatacgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
47493245 |
aatatatttaactttaaataatatttaaggtggtagattaatccttaaaaaaaatggtagattagtggtaagagtttaatcttataatcttaagatacgt |
47493146 |
T |
|
| Q |
114 |
ttaagttttaaatgatcatacaattgttatcaatgacacaaaaattccccaattccccggcccttcaatcagattttgcacagaattcaaacaaacaatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47493145 |
ttaagttttaaatgatcatacaattgttatcaatgacacaaaaattccc----------------caatcagattttgcacagaattcaaacaaacaatt |
47493062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University