View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_low_4 (Length: 405)
Name: NF19750_low_4
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 58 - 399
Target Start/End: Original strand, 5753352 - 5753686
Alignment:
| Q |
58 |
cagtagctgcggcgcggagagtagacaatgacacaacgtggtttactgagagagagcatagagagaagacatatataaatagtggaagtcaattgtctaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5753352 |
cagtagctgcggcgcggagagtagacaatgacacaacgtggtttactgagagagagcgtagaatgaagacatatataaatagtggaagtcaattgtctaa |
5753451 |
T |
 |
| Q |
158 |
tgttatggtgggaaagatatggtgtcttttgcttcttttcatctgttagatcaatctaatgtactataacatgccacgtctacattcttttgaccaaatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5753452 |
tgttatggtgggaaagatatggtgtcttttgcttcttttcatctgttagatcaatctaatgtactataacatgccacgtctacattcttttaaccaaatt |
5753551 |
T |
 |
| Q |
258 |
atctcaaacaaaatgtttggtgacagagatggatattaagctgtaatccaatggcagatcgtaagtgaagaagcttttggtgttcatacttcatagtatt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
5753552 |
atctcaaacaaaatgtttggtgacagagatggataataagctgtaatccaatggcagatcttaagtgaagaagcttttggtg-------ttcatagtatt |
5753644 |
T |
 |
| Q |
358 |
gattttcttctcaaattcaacttaatttagtactaataatcg |
399 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5753645 |
gattttcttgtcaaattcaagttaatttagtactaataatcg |
5753686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University