View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19750_low_6 (Length: 375)
Name: NF19750_low_6
Description: NF19750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19750_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 7 - 359
Target Start/End: Original strand, 39104608 - 39104960
Alignment:
| Q |
7 |
ggagcagagataggattcgtttttgtcgtcgtgatggtggtggtggatgtggtactgataggctgtgctgcaataacattgtcaaaaagggatgcatcct |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104608 |
ggagcagggataggattcgtttttgtcgtcgtgatggtggtggtggatgtggtactgataggctgtgctgcaataacattgtcaaaaagggatgcatcct |
39104707 |
T |
|
| Q |
107 |
ttggtagagccaatgacctcagctgcttcccaagattaaggatggtttcttgacactctgccaacttttctgaagcggccgttatctccaagtcctgtag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104708 |
ttggtagagccaatgacctcagctgcttcccaagattaaggatggtttcttgacactctgccaacttttctgaagcggccgttatctccaagtcctgtag |
39104807 |
T |
|
| Q |
207 |
gatttagtaacactcttcaatacaataccaacatgaaaaacccaactataattcaatttgacaacattagtcaatcatacacatggagatatgcaggttc |
306 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104808 |
gatttggtaacactcttcaatacaataccaacatgaaaaacccaactataattcaatttgacaacattagtcaatcatacacatggagatatgcaggttc |
39104907 |
T |
|
| Q |
307 |
attattttccctaacttgtctattgtcaatctccaaacatcaagccttgattc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104908 |
attattttccctaacttgtctattgtcaatctccaaacatcaagccttgattc |
39104960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 209
Target Start/End: Complemental strand, 6085187 - 6085107
Alignment:
| Q |
129 |
ctgcttcccaagattaaggatggtttcttgacactctgccaacttttctgaagcggccgttatctccaagtcctgtaggat |
209 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| || |||||||| || ||||||||| | ||||| ||||| |
|
|
| T |
6085187 |
ctgcttctcaaggttaaggatggtttcttgacactctgccaatttctctgaagcagctgttatctcccattcctgcaggat |
6085107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University