View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19751_low_8 (Length: 227)
Name: NF19751_low_8
Description: NF19751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19751_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 70 - 147
Target Start/End: Original strand, 44531049 - 44531126
Alignment:
| Q |
70 |
cgatatttgtgtggaccgagcgtaacaggatatctcatttgcatttgcagctgtgtttgttatctgtctttctttggc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531049 |
cgatatttgtgtggaccgagcgtaacaggatatctcatttgcatttgcagctgtgtttgttatctgtctttctttggc |
44531126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University