View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19751_low_9 (Length: 207)
Name: NF19751_low_9
Description: NF19751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19751_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 20716786 - 20716975
Alignment:
| Q |
1 |
gccacaatttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataagggttaacctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20716786 |
gccacaatttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataagggttaacctga |
20716885 |
T |
 |
| Q |
101 |
tctctgtggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttctt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20716886 |
tctctgtggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttctt |
20716975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 35294291 - 35294107
Alignment:
| Q |
7 |
atttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataagggttaacctgatctctg |
106 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| ||||||| || |||||||||||||||||||||||| |||||||| ||||||||| ||||| |||| |
|
|
| T |
35294291 |
atttttgttcctgattttgtttgcaccatttaatcagagtgttctggcacaatgtgtgatggcagtgcaaccacggcggtaagggttagcctgacctcta |
35294192 |
T |
 |
| Q |
107 |
tggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttcttt |
191 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| ||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35294191 |
gcgttgcaatcgtagtaagattgtcccttttgaccacatgggatattattagccttaagggcaccatagctaatgtatcttcttt |
35294107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University