View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19752_high_3 (Length: 350)
Name: NF19752_high_3
Description: NF19752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19752_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 212 - 307
Target Start/End: Complemental strand, 29856686 - 29856592
Alignment:
| Q |
212 |
gttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaagttgaaaaatgaggatgagagatcatagaaagccataactta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29856686 |
gttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaagttg-aaaatgaggatgagagatcatagaaatccataactta |
29856592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 245 - 307
Target Start/End: Complemental strand, 21426105 - 21426043
Alignment:
| Q |
245 |
gcagcaagatgaaaatgtgaagttgaaaaatgaggatgagagatcatagaaagccataactta |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21426105 |
gcagcaagttgaaaatgtgaagttgaaaaatgaggatgagagatgatagaaagccataactta |
21426043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 207 - 307
Target Start/End: Original strand, 41311444 - 41311544
Alignment:
| Q |
207 |
gataagttttcaccaacataattctatgcgagggtgatgcagcaagatgaaaatgtgaagttgaaaaatgaggatgagagatcatagaaagccataactt |
306 |
Q |
| |
|
|||||||||||||| |||| |||||||| | || |||||||||||| ||||||||||||| || |||| |||| |||||| | ||| |||||| |||| |
|
|
| T |
41311444 |
gataagttttcaccgacatgattctatgtgtggatgatgcagcaagttgaaaatgtgaagatgccaaatagggatcagagattagagagagccatgactt |
41311543 |
T |
|
| Q |
307 |
a |
307 |
Q |
| |
|
| |
|
|
| T |
41311544 |
a |
41311544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University