View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19753_high_10 (Length: 239)
Name: NF19753_high_10
Description: NF19753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19753_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 83
Target Start/End: Complemental strand, 24180638 - 24180571
Alignment:
| Q |
16 |
atcttcatatatttactgatgtgcatctctacacttttccatctcttcatctctttgttcatatgaca |
83 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24180638 |
atcttcatctctttactgatgtgcatctctacacttccccatctcttcatctctttgttcatatgaca |
24180571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 24180541 - 24180492
Alignment:
| Q |
107 |
aatctagatcaatagcaggagtatgcttttcatgttcaattcaattttgc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24180541 |
aatctagatcaatagcaggagtatgcttttcatgttcaattcaattttgc |
24180492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 21149283 - 21149234
Alignment:
| Q |
107 |
aatctagatcaatagcaggagtatgcttttcatgttcaattcaattttgc |
156 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||||||||||||||| |
|
|
| T |
21149283 |
aatctagatcaatgacaagcgtatgcttttcatgttcaattcaattttgc |
21149234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 156
Target Start/End: Original strand, 18242895 - 18242944
Alignment:
| Q |
107 |
aatctagatcaatagcaggagtatgcttttcatgttcaattcaattttgc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18242895 |
aatctagatcaatagcaggagtatgcttttcatgttcaattcaattttgc |
18242944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 18242797 - 18242864
Alignment:
| Q |
16 |
atcttcatatatttactgatgtgcatctctacacttttccatctcttcatctctttgttcatatgaca |
83 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18242797 |
atcttcatctctttgctgatgtgcatctctacacttccccatctcttcatctctttgttcatatgaca |
18242864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University