View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19753_high_6 (Length: 289)
Name: NF19753_high_6
Description: NF19753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19753_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 37337556 - 37337282
Alignment:
| Q |
16 |
atgattgcaacatttataatcattagtttggcaaaggatttggaattttctagacgtgaaccaattaaatggtacatatggcctatgacatgtctccacg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
37337556 |
atgattgcaacatttataatcattagtttggcaaaggatttggaattttctagacgtgaaccaattaaatggtacatgtggcctatgacatgtctccatg |
37337457 |
T |
|
| Q |
116 |
gattgagttaacaaagcctctgtccctaatatat----------------atatgtcattgatgatatatttgatttgtatggaaacattgatgattgat |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37337456 |
gattgagttaacaaagcctctgtgcctaatatatatatatatatatatatatatgtcattgacgatatatttgatttgtatggaaacattgatgattgat |
37337357 |
T |
|
| Q |
200 |
gaacttactctctttacagatgctgtgcgatgacttggaaggtacaaaattattacatgtttctaactattttgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37337356 |
gaacttactctctttacagatgctgtgccatgacttggaaggtacaaaagtattacatgtttctaactattttgt |
37337282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 113 - 225
Target Start/End: Complemental strand, 36509558 - 36509457
Alignment:
| Q |
113 |
acggattgagttaacaaagcctctgtccctaatatatatatgtcattgatgatatatttgatttgtatggaaacattgatgattgatgaacttactctct |
212 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||| || | |||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36509558 |
acggattgagctcacaaagcctctatccctaatttaca----tcattgatgatatatttgatttttatggaaac-------attgatgaacttactctct |
36509470 |
T |
|
| Q |
213 |
ttacagatgctgt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36509469 |
ttacagatgctgt |
36509457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 36509652 - 36509603
Alignment:
| Q |
41 |
gtttggcaaaggatttggaattttctagacgtgaaccaattaaatggtac |
90 |
Q |
| |
|
||||| ||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36509652 |
gtttgccaaaggacttggaatttgctagagatgaaccaattaaatggtac |
36509603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University